Greening of Masonry Walls Research Project - What's growing on the walls? Molecular Techniques

In order to understand the biodeterioration of building stone, we need to understand the ecology of the organisms (often microbes) responsible. In this project, we need to find out which microbes are living in sandstone and how they respond to changes in the environment e.g. climatic variability.

Studying the microbial ecology of building stone is challenging, because the organisms involved are exceptionally tiny and highly diverse. To overcome this, we use modern molecular (DNA-based) techniques. Every organism has a unique genetic identity encoded in its DNA (a bit like a bar code). If we can read and decipher the code for stone-dwelling microbes, we can find out which species are present.

Our molecular analyses have four stages. First we collect samples of microbes from stone buildings. Many of the structures we study are protected, so we need a non-destructive sampling technique. To this end, we have pioneered a technique that uses sterile adhesive tape.

Next, we need to extract the DNA molecules from the microbial cells that we collect. We use biochemical methods to break open the cell membranes and isolate the DNA within. When this process is complete, we are left with a few millionths of a gram of DNA, dissolved in a single drop of water.

Having extracted the DNA, we need to produce sufficient quantities for further analysis. We do this using a technique known as polymerase chain reaction (PCR). In the PCR process, we utilise an enzyme to make billions of copies of the target DNA.

When we have obtained enough DNA, we can take a subset of the DNA molecules and identify specific organisms by reading their genetic code, a process known as sequencing. We can also describe the composition of the community as a whole with a process known as terminal restriction length polymorphism (or DNA fingerprinting, for short!)

What microbes live on/in stone?

Building stone is a tough habitat, but it is home for a range of microorganisms, including algae, bacteria and fungi. The number of different microbial species that can live on stone is not known, but it is likely to be very high (many thousands, if not millions).

How do microbes contribute to stone deterioration?

The microbes that live in stone are exceptionally tiny (just a few millionths of a metre long), but they may be very numerous (millions of cells per gram of stone). It is known that substances produced by microbes can lead to the chemical transformation of the minerals in stone. The expansion and contraction of cells during wetting/drying can lead to physical damage. Coloured pigments present in microbial cells (e.g. the green chlorophyll in algal and cyanobacterial cells) can discolour stone. Furthermore, dust and pollutants can adhere to sticky microbial biofilms.

Why use molecular techniques?

Until comparatively recently, microbes were grown in the laboratory (cultured) and identified under a microscope. This is a tried-and-tested approach, but it has a number of drawbacks. Only a small fraction (estimated at 0.1 - 10%) of microbes can be successfully cultured and the time-consuming process of microscopic examination requires great expertise. Furthermore, not all microbes can be reliably identified according to their appearance under a microscope. Modern molecular techniques can also be time-consuming, but they are generally more reliable as they do not depend on morphological features for identification. Furthermore, they allow all of the organisms present in an environmental sample to be studied.

How difficult is molecular ecology?

Modern molecular techniques are extremely sophisticated and utilise very sensitive equipment. Experiments often fail for no apparent reason and contamination of samples is a constant concern. Certain samples are uncooperative and require a great deal of work to extract useful information. However, the basic molecular methods that we use have now been developed to the point that they can be followed like recipes: much of the work that we do is a bit like baking.

How does PCR work?

PCR is a multistage process. In the first stage, denaturation, double-stranded sample DNA is heated up and 'unzipped' so that they can be copied. In the second stage (annealing), small molecules known as primers attach themselves to the single-stranded DNA. Pairs of primers define the start and end of the section of DNA that we are interested in (the DNA template). In the third stage (elongation), the template section is copied by an enzyme known as Taq. Taq is derived from a bacterium, Thermus aquaticus, which lives in hot springs in the Yellowstone National Park, USA. The enzyme takes nucleotides, the raw material of the DNA molecule and assembles them in the correct order, using the primers as a guide of where to start and finish. The process is then repeated 30-40 times: in subsequent stages, the Taq makes copies of copies, so the number of amplicons (copied DNA molecules) increases very rapidly.

What is cloning, and how is it used to identify microorganisms?

We use cloning to produce copies of DNA from a particular organism (PCR produces copies of DNA from all the microbes we are interested in). During cloning, single strands of sample DNA are introduced into cells of the bacterium Escherichia coli. The E. coli cells are then cultured in the laboratory. The E. coli grows and divides many times to form a colony of bacterial cells. Copies of the sample DNA are created each time the E. coli cell divides. Each colony is founded by a single cell, hence each colony contains millions of copies of a single strand of DNA. We can select individual colonies, extract the DNA and remove the genetic signal from the E. coli. The left over DNA is then analysed in a sequencher, which reads the code of the DNA strand. Each of the constituent molecules of the DNA is represented by one of four letters (A, T, C or G). The final output is a string of 500 -100 letters that corresponds to the genetic code of the sample microbe. We can then compare this sequence to those stored in online databases to identify the microbe. The sequence below is from the common alga, Chlorella vulgaris:
TAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAACTGCTTTATACTGTGAAA
CTGCGAATGGCTCATTAAATCAGTTATAGTTTATTTGATGGTACTTACTACTCGGATACCCGTAGTA
AATCTAGAGCTAATACGTGCGTAAATCCCGACTTCTGGAAGGGACGTATTTATTAGATAAAAGGCC
GACCGGGCTTCTGCCCGACTCGCGGTGAATCATGATAACTTCACGAATCGCATGGCCTTGTGCCGG
CGATGTTTCATTCAAATTTCTGCCCTATCAACTTTTGATGGTAGGATAGAGGCCTACCATGGTGGTA
ACGGGTGACGGAGGATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCA
AGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACAGGGAGGTAGTGACAATAAATAACA
ATACTGGGCCTTTTCAGGTCTGGTAATTGGAATGAGTACAATCTAAACCCCTTAACGAGGATCAATT
GGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGCTG
CAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGACCTGCCGGTCCGCCGTTTCGGTGTGCACTG

How does DNA fingerprinting work?

Our samples contain a mixture of DNA from all of the organisms present in the stone. It isn't usually practical to individually analyse all of the DNA strands by cloning and sequencing: there are just too many. But we can characterise whole community as a whole. For example, we can broadly define basic ecological parameters such as biodiversity. This is important, as community structure is a key factor in determining the behaviour and function of biological communities.

In the DNA fingerprinting process, amplified DNA strands are cut up with a molecule known as a restriction enzyme. Each strand is cut where a particular genetic sequence occurs. As the precise genetic sequence varies from species to species, the cuts should occur at different points along the DNA strand, leading to DNA fragments of different lengths. By measuring the lengths of the cut strands and calculating their abundance, we can infer the relative abundance of different species in the community and hence the diversity of the community as a whole.

Back to Conserving Stone Heritage